Review

control shrna plasmid shctr (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc control shrna plasmid shctr

A Barplot showing the expression of SPINK2 measured by qPCR in a panel of AML cell lines. n = 6 for each cell line. B Bowtie plot representing SPINK2 mRNA quantification by q-PCR following SPINK2 <t>shRNA</t> silencing and normalized using GAPDH ( n = 6). C Lineplot displaying cell viability upon SPINK2 knock-down determined by counting cells every 24 h for four consecutive days post shRNA induction. The results are indicative of 3 independent experiments ( n = 6). D Two-dimensional flow cytometric dot plot showing BrdU incorporation 72 hours post doxycycline induction. The three gates indicate the G0/G1, S and G2/M phases of the cell cycle. The barplot on the righthand side represent an average of three independent experiments ( n = 6). E Bowtie plot showing the percentages of Annexin V + apoptotic/necrotic cells. F Representative two-dimensional flow cytometric contour plots showing the expression levels of CD14, CD64, CD35 and CD300E in FUJIOKA cells that have undergone SPINK2 silencing 96 hours post doxycycline induction ( n = 6). The statistical analysis reported in this figure have been performed using student’s t test (*** p < 0.001, * p < 0.05).

Control Shrna Plasmid Shctr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+shctr/Tet-pLKO-puro-Scrambled+(Plasmid+%2347541)/pmc13039488-174-2-7
Average 93 stars, based on 36 article reviews

control shrna plasmid shctr - by Bioz Stars, 2026-10

93/100 stars

Images

1) Product Images from "SPINK2 silencing suppresses leukemic proliferation and restores myeloid commitment via MECOM downregulation in acute myeloid leukaemia"

Article Title: SPINK2 silencing suppresses leukemic proliferation and restores myeloid commitment via MECOM downregulation in acute myeloid leukaemia

Journal: Cell Death Discovery

doi: 10.1038/s41420-026-02988-1

Figure Legend Snippet: A Barplot showing the expression of SPINK2 measured by qPCR in a panel of AML cell lines. n = 6 for each cell line. B Bowtie plot representing SPINK2 mRNA quantification by q-PCR following SPINK2 shRNA silencing and normalized using GAPDH ( n = 6). C Lineplot displaying cell viability upon SPINK2 knock-down determined by counting cells every 24 h for four consecutive days post shRNA induction. The results are indicative of 3 independent experiments ( n = 6). D Two-dimensional flow cytometric dot plot showing BrdU incorporation 72 hours post doxycycline induction. The three gates indicate the G0/G1, S and G2/M phases of the cell cycle. The barplot on the righthand side represent an average of three independent experiments ( n = 6). E Bowtie plot showing the percentages of Annexin V + apoptotic/necrotic cells. F Representative two-dimensional flow cytometric contour plots showing the expression levels of CD14, CD64, CD35 and CD300E in FUJIOKA cells that have undergone SPINK2 silencing 96 hours post doxycycline induction ( n = 6). The statistical analysis reported in this figure have been performed using student’s t test (*** p < 0.001, * p < 0.05).

Techniques Used: Expressing, shRNA, Knockdown, BrdU Incorporation Assay

Control:

Article Title: Radiosynthesis and validation of (±)-[ 18 F]-3-fluoro-2-hydroxypropionate ([ 18 F]-FLac) as a PET tracer of lactate to monitor MCT1-dependent lactate uptake in tumors
Article Snippet: MCT1-deficient and control SiHa cells were produced as previously described [ ], using the following vectors from Open Biosystems: TRCN0000038340 (shMCT1-1) and TRCN0000038339 (shMCT1-2). .. Control shRNA (shCTR) was Addgene plasmid 1864. .. SiHa-CRISPR-MCT1 cells were produced using Sigma LentiCRISPR (Target Site GTATAGTCATGATTGTTGGTGG), and transformed cells were selected using puromycin.

Article Title: Lactate Activates HIF-1 in Oxidative but Not in Warburg-Phenotype Human Tumor Cells
Article Snippet: MCT1 shRNAs were purchased from Open Biosystems (clone TRCN0000038340 = shMCT1-1 and clone TRCN0000038478 = shMCT1-2). .. Control shRNA (shCTR) was Addgene plasmid 1864. ..

Article Title: [18F]-labelled lactate derivative as PET radiotracer
Article Snippet: MCT1-deficient and control SiHa cells were produced as previously described (De Saedeleer et al., Oncogene, 2014, 33, 4060-4068), using the following vectors from Open Biosystems: TRCN0000038340 (shMCT1-1) and TRCN0000038339 (shMCT1-2). .. Control shRNA (shCTR) was Addgene plasmid 1864. ..

Article Title: Glucose deprivation increases monocarboxylate transporter 1 (MCT1) expression and MCT1-dependent tumor cell migration.
Article Snippet: .. Control shRNA (shCTR) was Addgene plasmid 1864 (Cambridge, MA, USA). .. To obtain cells overexpressing MCT1 or CD147, we used the MCT1 cDNA expression vector pCMV6-Entry/mct1 (OriGene Technologies, Rockville, MD, USA) and full-length rat CD147 cDNA in a pCI-neo vector (kind gift of Professor J Pouysségur).

Article Title: [
Article Snippet: MCT1-deficient and control SiHa cells were produced as previously described (De Saedeleer et al., Oncogene, 2014, 33, 4060-4068), using the following vectors from Open Biosystems: TRCN0000038340 (shMCT1-1) and TRCN0000038339 (shMCT1-2). .. Control shRNA (shCTR) was Addgene plasmid 1864. ..

Article Title: Lactate activates HIF-1 in oxidative but not in Warburg-phenotype human tumor cells.
Article Snippet: MCT1 shRNAs were purchased from Open Biosystems (clone TRCN0000038340 = shMCT1-1 and clone TRCN0000038478 = shMCT1-2). .. Control shRNA (shCTR) was Addgene plasmid 1864. ..

shRNA:

Plasmid Preparation:

Image Search Results

Journal: Cell Death Discovery

Article Title: SPINK2 silencing suppresses leukemic proliferation and restores myeloid commitment via MECOM downregulation in acute myeloid leukaemia

doi: 10.1038/s41420-026-02988-1

Figure Lengend Snippet: A Barplot showing the expression of SPINK2 measured by qPCR in a panel of AML cell lines. n = 6 for each cell line. B Bowtie plot representing SPINK2 mRNA quantification by q-PCR following SPINK2 shRNA silencing and normalized using GAPDH ( n = 6). C Lineplot displaying cell viability upon SPINK2 knock-down determined by counting cells every 24 h for four consecutive days post shRNA induction. The results are indicative of 3 independent experiments ( n = 6). D Two-dimensional flow cytometric dot plot showing BrdU incorporation 72 hours post doxycycline induction. The three gates indicate the G0/G1, S and G2/M phases of the cell cycle. The barplot on the righthand side represent an average of three independent experiments ( n = 6). E Bowtie plot showing the percentages of Annexin V + apoptotic/necrotic cells. F Representative two-dimensional flow cytometric contour plots showing the expression levels of CD14, CD64, CD35 and CD300E in FUJIOKA cells that have undergone SPINK2 silencing 96 hours post doxycycline induction ( n = 6). The statistical analysis reported in this figure have been performed using student’s t test (*** p < 0.001, * p < 0.05).

Article Snippet: A scrambled control shRNA plasmid (shCtr), Tet-pLKO-puro-Scrambled (Addgene plasmid #47541), was used as a non-targeting control [ ].

Techniques: Expressing, shRNA, Knockdown, BrdU Incorporation Assay

a Areaproportional Venn diagram of gene sets enriched with EIF4EBP1 expression in cohort 1 (A) and 2 (B) as well as with chr8 gain in cohort 2 (C) as determined by fGSEA. Exemplary gene sets representing a proliferation-associated enrichment signature in the overlap between A, B, and C were shown with respective normalized enrichment scores (NES) and significance levels. b fGSEA enrichment plots of exemplary gene sets given in (a). c Relative viable cell count of A-673, SK-N-MC, and TC-71 cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr). Cells were grown either with or without Dox for 96h. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 4 biologically independent experiments. d Sphere formation in A-673, SK-N-MC, and TC-71 cells containing shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr) treated with or without Dox for 8–14 d. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 3 biologically independent experiments. Two-tailed unpaired t-test with Welch’s correction. Representative images of spheres are shown on the right. e Relative colony number of A-673 and SK-N-MC cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a nontargeting shControl (shCtr). Cells were grown either with or without Dox for 8–14 d. Horizontal bars represent means, and whiskers the SEM, n ≥ 4 biologically independent experiments. Representative images of colony formation are shown on the right. f Kaplan-Meier analysis of event-free survival of NSG mice xenografted with A-673 cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr). Once tumors were palpable, mice were randomized and treated with either vehicle (–) or Dox (+), n ≥ 5 animals per condition. An ‘event’ is recorded when tumors reached a size maximum of 15 mm in one dimension. P -values determined via Mantel-Haenszel test. g Quantification of mitoses in HE-stained slides of xenografts described in (f). Five high-power fields (HPF) were counted per sample. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 4 samples per condition. *** P < 0.001, ** P < 0.01, * P < 0.05, ns = not significant; P -values determined via two-tailed Mann-Whitney test if not otherwise specified.

Journal: bioRxiv

Article Title: Chromosome 8 gain drives poor patient outcome via expression of 4E-BP1 in Ewing sarcoma

doi: 10.1101/2022.12.11.519935

Figure Lengend Snippet: a Areaproportional Venn diagram of gene sets enriched with EIF4EBP1 expression in cohort 1 (A) and 2 (B) as well as with chr8 gain in cohort 2 (C) as determined by fGSEA. Exemplary gene sets representing a proliferation-associated enrichment signature in the overlap between A, B, and C were shown with respective normalized enrichment scores (NES) and significance levels. b fGSEA enrichment plots of exemplary gene sets given in (a). c Relative viable cell count of A-673, SK-N-MC, and TC-71 cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr). Cells were grown either with or without Dox for 96h. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 4 biologically independent experiments. d Sphere formation in A-673, SK-N-MC, and TC-71 cells containing shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr) treated with or without Dox for 8–14 d. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 3 biologically independent experiments. Two-tailed unpaired t-test with Welch’s correction. Representative images of spheres are shown on the right. e Relative colony number of A-673 and SK-N-MC cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a nontargeting shControl (shCtr). Cells were grown either with or without Dox for 8–14 d. Horizontal bars represent means, and whiskers the SEM, n ≥ 4 biologically independent experiments. Representative images of colony formation are shown on the right. f Kaplan-Meier analysis of event-free survival of NSG mice xenografted with A-673 cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr). Once tumors were palpable, mice were randomized and treated with either vehicle (–) or Dox (+), n ≥ 5 animals per condition. An ‘event’ is recorded when tumors reached a size maximum of 15 mm in one dimension. P -values determined via Mantel-Haenszel test. g Quantification of mitoses in HE-stained slides of xenografts described in (f). Five high-power fields (HPF) were counted per sample. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 4 samples per condition. *** P < 0.001, ** P < 0.01, * P < 0.05, ns = not significant; P -values determined via two-tailed Mann-Whitney test if not otherwise specified.

Article Snippet: Human EwS cell lines A-673, SK-N-MC, and TC-71 were transduced with lentiviral Tet-pLKO-puro all-in-one vector system (plasmid #21915, Addgene) containing a puromycin-resistance cassette, and a tet-responsive element for Dox-inducible expression of shRNAs against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting control shRNA (shCtr).

Techniques: Expressing, Cell Counting, shRNA, Construct, Two Tailed Test, Staining, MANN-WHITNEY

a Relative EIF4EBP1 expression in 21 wild-type EwS cell lines as determined by qRT-PCR. b Relative EIF4EBP1 expression as assessed by qRT-PCR in A-673, SK-N-MC, and TC-71 cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr). Cells were grown either with or without Dox for 96h. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 3 biologically independent experiments. c Relative 4E-BP1 expression as assessed by quantified western blotting in A-673, SK-N-MC, and TC-71 cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr). Cells were grown either with or without Dox for 96h. P -values determined via one-tailed Mantel-Haenszel test. d Representative western blots as described in (b) are shown. ß-actin served as a loading control. e Relative number of dead cells as assessed by Trypan blue exclusion in A-673, SK-N-MC, and TC-71 cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr). Cells were grown either with or without Dox for 96h. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 4 biologically independent experiments. f Kaplan-Meier analysis of event-free survival of NSG mice xenografted with TC-71 cells containing Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2). Once tumors were palpable, mice were randomized and treated with either vehicle (–) or Dox (+), n =8 animals per condition. An ‘event’ is recorded when tumors reached a size maximum of 15 mm in one dimension. P -values determined via Mantel-Haenszel test. g Quantification of mitoses in HE-stained slides of xenografts described in (f). Five high-power fields (HPF) were counted per sample. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 7 samples per condition. h Quantification of necrotic area on HE-stained slides of A-673 xenografts described in (f). Five high-power fields (HPF) were analyzed per sample. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 5 samples per condition. i Quantification of necrotic area on HE-stained slides of TC-71 xenografts described in (f). Five high-power fields (HPF) were analyzed per sample. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 7 samples per condition. j Kaplan-Meier analysis of event-free survival of NSG mice orthotopically xenografted into the proximal tibia with TC-71 containing a Dox-inducible specific shRNA construct directed against EIF4EBP1 (sh4E-BP1_2). One day after injection of the cells, mice were randomized and treated with either vehicle (−) or Dox (+), n =5 animals per condition. An ‘event’ is recorded when the mice exhibited signs of limping at the injected leg. P -values determined via Mantel-Haenszel test. *** P < 0.001, ** P < 0.01, * P < 0.05, ns = not significant; P values determined via two-tailed Mann-Whitney test if not otherwise specified.

Journal: bioRxiv

Article Title: Chromosome 8 gain drives poor patient outcome via expression of 4E-BP1 in Ewing sarcoma

doi: 10.1101/2022.12.11.519935

Figure Lengend Snippet: a Relative EIF4EBP1 expression in 21 wild-type EwS cell lines as determined by qRT-PCR. b Relative EIF4EBP1 expression as assessed by qRT-PCR in A-673, SK-N-MC, and TC-71 cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr). Cells were grown either with or without Dox for 96h. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 3 biologically independent experiments. c Relative 4E-BP1 expression as assessed by quantified western blotting in A-673, SK-N-MC, and TC-71 cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr). Cells were grown either with or without Dox for 96h. P -values determined via one-tailed Mantel-Haenszel test. d Representative western blots as described in (b) are shown. ß-actin served as a loading control. e Relative number of dead cells as assessed by Trypan blue exclusion in A-673, SK-N-MC, and TC-71 cells containing either Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2) or a non-targeting shControl (shCtr). Cells were grown either with or without Dox for 96h. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 4 biologically independent experiments. f Kaplan-Meier analysis of event-free survival of NSG mice xenografted with TC-71 cells containing Dox-inducible specific shRNA constructs directed against EIF4EBP1 (sh4E-BP1_1 or sh4E-BP1_2). Once tumors were palpable, mice were randomized and treated with either vehicle (–) or Dox (+), n =8 animals per condition. An ‘event’ is recorded when tumors reached a size maximum of 15 mm in one dimension. P -values determined via Mantel-Haenszel test. g Quantification of mitoses in HE-stained slides of xenografts described in (f). Five high-power fields (HPF) were counted per sample. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 7 samples per condition. h Quantification of necrotic area on HE-stained slides of A-673 xenografts described in (f). Five high-power fields (HPF) were analyzed per sample. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 5 samples per condition. i Quantification of necrotic area on HE-stained slides of TC-71 xenografts described in (f). Five high-power fields (HPF) were analyzed per sample. Horizontal bars represent means, and whiskers represent the SEM, n ≥ 7 samples per condition. j Kaplan-Meier analysis of event-free survival of NSG mice orthotopically xenografted into the proximal tibia with TC-71 containing a Dox-inducible specific shRNA construct directed against EIF4EBP1 (sh4E-BP1_2). One day after injection of the cells, mice were randomized and treated with either vehicle (−) or Dox (+), n =5 animals per condition. An ‘event’ is recorded when the mice exhibited signs of limping at the injected leg. P -values determined via Mantel-Haenszel test. *** P < 0.001, ** P < 0.01, * P < 0.05, ns = not significant; P values determined via two-tailed Mann-Whitney test if not otherwise specified.

Techniques: Expressing, Quantitative RT-PCR, shRNA, Construct, Western Blot, One-tailed Test, Staining, Injection, Two Tailed Test, MANN-WHITNEY

Metabolic changes in H295R cells related to ERRα expression levels. The metabolic profiles of H295R wild type (WT), shCTR, shERRα−/− and ERRα+/+ cells were assessed by Seahorse XFe96 Analyzer. ( a , b ) ATP Rate Assay was evaluated as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of Total ATP Production Rate (pmol/min) ( a ) and ATP production (%) ( b ) deriving from glycolysis and oxidative phosphorylation after the sequential addition of specific inhibitors; (* p < 0.05 vs. WT). ( c – e ) Mitochondrial Stress Analysis was performed as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of real-time oxygen consumption (OCR) rate (pmol/min/cells); (* p < 0.05 vs. shCTR). Mitochondrial Respiration ( c ), Basal Respiration ( d ), Maximal Respiration ( e ) were measured from OCR after the addition of specific inhibitors. ( f – h ) Glycolytic Stress Analysis was performed as indicated in “Materials and Methods”. Graph represents the mean ± SD of three independent experiments of Real-time extracellular acidification (ECAR) rate (mpH/min/cells); (* p < 0.05 vs. shCTR). Glycolitic function ( f ), Glycolysis ( g ) and Glycolytic Capacity ( h ) were measured from ECAR after the addition of specific inhibitors.

Journal: Cancers

Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression

doi: 10.3390/cancers14163885

Figure Lengend Snippet: Metabolic changes in H295R cells related to ERRα expression levels. The metabolic profiles of H295R wild type (WT), shCTR, shERRα−/− and ERRα+/+ cells were assessed by Seahorse XFe96 Analyzer. ( a , b ) ATP Rate Assay was evaluated as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of Total ATP Production Rate (pmol/min) ( a ) and ATP production (%) ( b ) deriving from glycolysis and oxidative phosphorylation after the sequential addition of specific inhibitors; (* p < 0.05 vs. WT). ( c – e ) Mitochondrial Stress Analysis was performed as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of real-time oxygen consumption (OCR) rate (pmol/min/cells); (* p < 0.05 vs. shCTR). Mitochondrial Respiration ( c ), Basal Respiration ( d ), Maximal Respiration ( e ) were measured from OCR after the addition of specific inhibitors. ( f – h ) Glycolytic Stress Analysis was performed as indicated in “Materials and Methods”. Graph represents the mean ± SD of three independent experiments of Real-time extracellular acidification (ECAR) rate (mpH/min/cells); (* p < 0.05 vs. shCTR). Glycolitic function ( f ), Glycolysis ( g ) and Glycolytic Capacity ( h ) were measured from ECAR after the addition of specific inhibitors.

Article Snippet: After 48 h, cells were transfected with DNA plasmids: a plasmid encoding a scrambled short hairpin RNAs (shRNA) sequence (shCTR) (Santa Cruz, sc108060, Dallas, TX, USA), a plasmid expressing a shRNA to inhibit ERRα gene (shERRα−/−) (Santa Cruz, sc44706-sh), according to the manufacturer’s protocol (Santa Cruz Biotecnology, https://www.scbt.com/it/resources/protocols/shrna-plasmid-dna-mediated-inhibition-of-gene-expression (accessed on 7 January 2020)), or ERRα cDNA expression plasmid(ERRα+/+) (ADGENE, #10975), according to X-tremeGENETM HP DNA Transfection Reagent Protocol (Sigma).

Techniques: Expressing, Phospho-proteomics

ERRα modulates H295R cell motility and Vimentin expression. ( a , b ) H295R (WT), H295R clones, knock in (ERRα+/+) or knock out (shERRα−/−) for ERRα gene, and H295R cell stably transfected with control plasmid (shCTR) were used in Wound Healing ( a ) and Boyden Chamber ( b ) assays as reported in “Materials and Methods”. Images are from a representative experiment. ( c , d ) H295R cells were treated with vehicle (0) or XCT790 (1, 5, 10 μM) for 18 h and Wound Healing ( c ) and Boyden Chamber ( d ) assays were performed as reported in “Materials and Methods”. Images are from a representative experiment. ( c ) The wounds were observed under an inverted microscope immediately (0 h) and 18 h after the scratch (100× magnification). ( b , d ) Migrated cells were photographed under an inverted microscope and counted (see Material and Methods), 20× magnification. Graphs represent the mean ± SD of three independent experiments. The number of untreated cells (0) was set as 100% (* p < 0.05 vs. 0). ( e ) Total proteins from H295R clones (shCTR, shERRα−/−, ERRα+/+) were analyzed by western Blotting (WB) using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. Blots are representative of three independent experiments with similar results. ( f ) H295R were transfected for 48 h with pcDNA3.1 non containing (EV) or containing ERRα coding sequence (pcDNA3.1-ERRα). After transfection cells were left untreated (−) or treated (+) for 24 h with XCT790 (10 μM). Total proteins were analyzed by WB using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. ( g ) Cells were untreated (0) or treated with XCT790 (1, 5, 10 μM) for 24 h. Total proteins were analyzed by WB using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. Original image of western blot can be found at .

Journal: Cancers

Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression

doi: 10.3390/cancers14163885

Figure Lengend Snippet: ERRα modulates H295R cell motility and Vimentin expression. ( a , b ) H295R (WT), H295R clones, knock in (ERRα+/+) or knock out (shERRα−/−) for ERRα gene, and H295R cell stably transfected with control plasmid (shCTR) were used in Wound Healing ( a ) and Boyden Chamber ( b ) assays as reported in “Materials and Methods”. Images are from a representative experiment. ( c , d ) H295R cells were treated with vehicle (0) or XCT790 (1, 5, 10 μM) for 18 h and Wound Healing ( c ) and Boyden Chamber ( d ) assays were performed as reported in “Materials and Methods”. Images are from a representative experiment. ( c ) The wounds were observed under an inverted microscope immediately (0 h) and 18 h after the scratch (100× magnification). ( b , d ) Migrated cells were photographed under an inverted microscope and counted (see Material and Methods), 20× magnification. Graphs represent the mean ± SD of three independent experiments. The number of untreated cells (0) was set as 100% (* p < 0.05 vs. 0). ( e ) Total proteins from H295R clones (shCTR, shERRα−/−, ERRα+/+) were analyzed by western Blotting (WB) using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. Blots are representative of three independent experiments with similar results. ( f ) H295R were transfected for 48 h with pcDNA3.1 non containing (EV) or containing ERRα coding sequence (pcDNA3.1-ERRα). After transfection cells were left untreated (−) or treated (+) for 24 h with XCT790 (10 μM). Total proteins were analyzed by WB using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. ( g ) Cells were untreated (0) or treated with XCT790 (1, 5, 10 μM) for 24 h. Total proteins were analyzed by WB using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. Original image of western blot can be found at .

Techniques: Expressing, Clone Assay, Knock-In, Knock-Out, Stable Transfection, Transfection, Control, Plasmid Preparation, Inverted Microscopy, Western Blot, Sequencing

ERRα promotes H295R spheroids formation. ( a ) H295R were transfected for 48 h with pcDNA3.1 non containing (EV) or containing ERRα coding sequence (pcDNA3.1-ERRα) and then grown as 3D spheroids for 5 days. Spheroids were counted under an inverted microscope and results were expressed as fold change over control (EV) ± SD (TSFE, tumor spheroids formation efficiency); (* p < 0.05 vs. EV). Insert confirms ERRα overexpression. ( b ) H295R cells were left untreated (0) or treated with XCT790 (1, 5, 10 μM) for 24 h and TSFE was evaluated 5 days later (* p < 0.05 vs. 0). Images below graph are from a representative experiment (20× magnification). ( c ) Wild type H295R (WT) and H295R clones (shCTR, shERRα−/−, ERRα+/+) were used to evaluate 3D spheroids formation. TSFE was evaluated 5 days later (* p < 0.05 vs. WT). Images below graph are from a representative experiment (20× magnification). ( d ) H295R spheroids (H295R Sph-5) were allowed to grow for 5 days and then trypsinized and reseeded weekly in spheroid media for 5 weeks. Boyden Chamber Assay was performed as reported in the “Materials and Methods”. Migrated cells were randomly photographed and counted with ImageJ software (* p < 0.05 vs. WT). ( e ) H295R (WT) cells and H295R grown as spheroids for 5 weeks (H295R Sph-5), were analyzed by WB using antibody against Vimentin. GAPDH was used as a loading control. Blots are representative of three independent experiments with similar results. Original image of western blot can be found at .

Journal: Cancers

Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression

doi: 10.3390/cancers14163885

Figure Lengend Snippet: ERRα promotes H295R spheroids formation. ( a ) H295R were transfected for 48 h with pcDNA3.1 non containing (EV) or containing ERRα coding sequence (pcDNA3.1-ERRα) and then grown as 3D spheroids for 5 days. Spheroids were counted under an inverted microscope and results were expressed as fold change over control (EV) ± SD (TSFE, tumor spheroids formation efficiency); (* p < 0.05 vs. EV). Insert confirms ERRα overexpression. ( b ) H295R cells were left untreated (0) or treated with XCT790 (1, 5, 10 μM) for 24 h and TSFE was evaluated 5 days later (* p < 0.05 vs. 0). Images below graph are from a representative experiment (20× magnification). ( c ) Wild type H295R (WT) and H295R clones (shCTR, shERRα−/−, ERRα+/+) were used to evaluate 3D spheroids formation. TSFE was evaluated 5 days later (* p < 0.05 vs. WT). Images below graph are from a representative experiment (20× magnification). ( d ) H295R spheroids (H295R Sph-5) were allowed to grow for 5 days and then trypsinized and reseeded weekly in spheroid media for 5 weeks. Boyden Chamber Assay was performed as reported in the “Materials and Methods”. Migrated cells were randomly photographed and counted with ImageJ software (* p < 0.05 vs. WT). ( e ) H295R (WT) cells and H295R grown as spheroids for 5 weeks (H295R Sph-5), were analyzed by WB using antibody against Vimentin. GAPDH was used as a loading control. Blots are representative of three independent experiments with similar results. Original image of western blot can be found at .

Techniques: Transfection, Sequencing, Inverted Microscopy, Control, Over Expression, Clone Assay, Boyden Chamber Assay, Software, Western Blot

ERRα expression levels and cholesterol influence H295R cell migration. ( a ) H295R clones (shCTR, ERRα+/+, shERRα−/−) were maintained in 5% FBS or 5% LpFS containing medium. Cells were used in Wound Healing ( a ) and Boyden Chamber ( b ) assays performed as reported in “Materials and Methods”. ( a ) Images are from a representative experiment (100× magnification). ( b ) Migrated cells were photographed under an inverted microscope (20× magnification) and counted with ImageJ software. Graphs represent the mean ± SD of three independent experiments (* p < 0.05 vs. FBS).

Journal: Cancers

Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression

doi: 10.3390/cancers14163885

Figure Lengend Snippet: ERRα expression levels and cholesterol influence H295R cell migration. ( a ) H295R clones (shCTR, ERRα+/+, shERRα−/−) were maintained in 5% FBS or 5% LpFS containing medium. Cells were used in Wound Healing ( a ) and Boyden Chamber ( b ) assays performed as reported in “Materials and Methods”. ( a ) Images are from a representative experiment (100× magnification). ( b ) Migrated cells were photographed under an inverted microscope (20× magnification) and counted with ImageJ software. Graphs represent the mean ± SD of three independent experiments (* p < 0.05 vs. FBS).

Techniques: Expressing, Migration, Clone Assay, Inverted Microscopy, Software

PHGDH knockdown potentiates bortezomib and proteasome-resistant cell lines are sensitive to PHGDH inhibition. a The knockdown of PHGDH using shRNA was confirmed via WB. b CTG was used to highlight the dependence of the shPHGDH cells on extracellular serine. The sensitivity to drugs was tested by CTG. c , d INA6 KD cells were treated overnight with carfilzomib and bortezomib, respectively. e , f INA6-res and AMO1-res cell lines, respectively, were treated with the indicated doses of NCT-503 overnight. All the presented graphs and calculated IC50s represent three independent experiments with minimum two replicates. Error bars are ± SEM and * P ≤ 0.05 , ** P ≤ 0.01, *** P ≤ 0.001

Journal: Experimental Hematology & Oncology

Article Title: Targeting phosphoglycerate dehydrogenase in multiple myeloma

doi: 10.1186/s40164-020-00196-w

Figure Lengend Snippet: PHGDH knockdown potentiates bortezomib and proteasome-resistant cell lines are sensitive to PHGDH inhibition. a The knockdown of PHGDH using shRNA was confirmed via WB. b CTG was used to highlight the dependence of the shPHGDH cells on extracellular serine. The sensitivity to drugs was tested by CTG. c , d INA6 KD cells were treated overnight with carfilzomib and bortezomib, respectively. e , f INA6-res and AMO1-res cell lines, respectively, were treated with the indicated doses of NCT-503 overnight. All the presented graphs and calculated IC50s represent three independent experiments with minimum two replicates. Error bars are ± SEM and * P ≤ 0.05 , ** P ≤ 0.01, *** P ≤ 0.001

Article Snippet: Following the manufacturer’s protocol, INA6 knockdown cells (INA6-KD) were transduced with lentiviral particles containing either non-target control shRNA (shCTR) or shRNA targeting PHGDH (shPHGDH) (Santa Cruz Biotechnology, Dallas, TX, USA; sc-108080 and sc-105011-V).

Techniques: Knockdown, Inhibition, shRNA

Review

control shrna plasmid shctr (Addgene inc)

Structured Review

Images

1) Product Images from "SPINK2 silencing suppresses leukemic proliferation and restores myeloid commitment via MECOM downregulation in acute myeloid leukaemia"

Related Articles

Control:

shRNA:

Plasmid Preparation:

Similar Products

Image Search Results